The FASTA .seq format is a text-based format for representing nucleotide or peptide sequences. Each sequence entry includes:

  • Header Line that begins with ‘>’ followed by a description.
  • Sequence Lines that contain the nucleotide (A, T, C, G for DNA) or peptide sequence, typically wrapped at a fixed width (commonly 60-80 characters).

Example:

>Sequence_1 Description
AGCTTGCTAGCTAGCTAGCTAGCTGATCGATCGTACGATCGTAGCTAGCTAGCTAG
>Sequence_2 Another description
CGTAGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGTACGATCGTAGCTAGCTAG

For more detailed information, please refer to the official NCBI FASTA specification.

Applications that read .seq:

  • pre_bunch - Rigid body modelling of multidomain proteins.

Applications that write .seq:

  • pdb2seq - Convert atomic models to residue sequence